Best HD Pcdna3 Vector Sequence Pictures

Posted on

Analyze sequence vector database protocols . welcome to vector database! vector database is digital collection of vector backbones embled from .Analyze sequence vector database . vector database is digital collection of vector backbones embled from publications . pcdna.+, pcdna., pcdna . Mammalian expression vector with the cmv promoter and neomycinresistance marker. This pcdna.(+) vector is designed for highlevel, consutive expression in variety of mammalian cell lines. it contains geneticin selectable marker and forwardorientation multiple cloning site.the pcdna.expression vector familythree untagged versions of pcdna.(available separately),

Linearized mammalian vector with ‘overhangs and bound topoisomerase, for topo ta cloning of pcr products and high level expression. Select from over , fulllength, sequence guaranteed cdna and orf clones targeting human, mouse, rat, bovine, . pcdna.cloning vector. Sequence >pcdna gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgccgcatagttaa gccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaa ggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtac . Vector pcdna. number of plasmids with this backbone name pcdna . vector map pcdna.pdf vector sequence pcdna.txt comments features type name